|
My program generates a latitude and longitude and I would like to display a map of the area with the exact location marked.
Is Google Maps the best way to go for this?
At the moment I do not want the map to be embedded in my program. I would be happy just to spawn the default web browser passing it a maps.google.com URL that would display the correct Google Map with the location marked accurately.
Is there a page which describes how to construct the necessary URL ?
Also, do Google allow this sort of use for free, or would their terms require a fee for programs which spawn the map in a web browser like this?
|
|
|
|
|
Does this[^] help?
Why not embed a browser (IE? WebKit if you're feeling ambitious) in your program? That'd be cool!
Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p
|
|
|
|
|
Thanks, that's a great help. Embedding a browser sounds interesting - I'm still using VC++ 2003, would that be too old to use WebKit?
Is there anything else provided by Microsoft that can be used to create a web browser within a program's window?
|
|
|
|
|
Note: WebKit is the open-source HTML engine used in Google Chrome and Apple Safari. It is wrapped in a class in the Qt library.
colinbr wrote: would that be too old to use WebKit?
No - but other than Qt, I'm not sure of easy ways of using it.
colinbr wrote: Is there anything else provided by Microsoft that can be used to create a web browser within a program's window?
IE. Use the MSHTML ActiveX control. It's pretty simple and (if you've already got an MFC program running) probably easiest.
Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p
|
|
|
|
|
Thanks, I'll look at that. When I created ny project originally I did not have ActiveX ticked in the project wizard. I don't relish the thought of recreating the project from scratch, so is there a simple list of changes I can make manually to the project files that would add ActiveX support?
Incidentally I found a reference to Microsoft's CHtmlView which I think is a wrapper around the ActiveX control - and also a CHtmlCtrl which allows CHtmlView to be used in a dialog window. But there seemed to be comments about memory leaks.
Would it be easier/safer to go for the ActiveX control itself - I guess this is
http://msdn.microsoft.com/en-us/library/aa752046%28VS.85%29.aspx[^]
or to go for the CHtmlView/CHtmlCtrl solution?
|
|
|
|
|
I would have thought that CHtmlView/CHtmlCtrl would wrap the ActiveX control. I'm not sure what's required for ActiveX support in MFC - I've only used the Web Browser ActiveX control in WTL, which doesn't require you to enable ActiveX support at a project level.
Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p
|
|
|
|
|
|
Hello Guys,
I am trying to handle key code for power key/switch off key for Windows mobile in MFC application but still to get the correct key code for the same.
Your inputs are most welcome. Waiting for your reply.
Thanks in advance.
Regards,
Rushikesh123
modified on Tuesday, September 29, 2009 12:43 AM
|
|
|
|
|
can we develop rtd client like excel to get data from rtd server
Trioum
|
|
|
|
|
Yes, we can.
For instance I'm a famous RTD (ready to drink) client.
If the Lord God Almighty had consulted me before embarking upon the Creation, I would have recommended something simpler.
-- Alfonso the Wise, 13th Century King of Castile.
This is going on my arrogant assumptions. You may have a superb reason why I'm completely wrong.
-- Iain Clarke
[My articles]
|
|
|
|
|
how is it possible
Trioum
|
|
|
|
|
trioum wrote: can we develop rtd client like excel to get data from rtd server
Yes, that should be possible. Question answered. Period.
But "how to develop an rtd client" may not be a specific question. You might want to read the guidelines in that case...
It is a crappy thing, but it's life -^ Carlo Pallini
|
|
|
|
|
Hi,
I need to compress wave-pcm to gsm-format with acm(audio compression manager).
So can you help me? and if there is some source codes it can be more helpful.
Thanks
|
|
|
|
|
Dear all,
How to pohibit some character on edit box VC 6.0?
I have no idea about that.
Thanks and regards,
Eka Candra
|
|
|
|
|
Check ON_EN_UPDATE message handler. Sent after the control has formatted the text but before it displays the text so that the window size can be altered, if necessary.
check this
Or In PreTranslateMessage(inside parent of edit box), you can do check for prohibited character -
if(pMsg->message == WM_KEYDOWN && pMsg->wParam == PROHIBITED_CHARACTER && pMsg->hWnd == MY_EDIT_BOX_WINDOW)
{
return TRUE;
}
|
|
|
|
|
Thank you for your help and answer.
I am not try it yet. Firstly, I will learn article that you give in your message.
thanks a lot...
|
|
|
|
|
Have a look in the Edit Controls[^] section here on codeproject - there are many good articles here (thought that tutorial is a great start)
Masked and Validating Controls[^] is probably the subsection you want!
Iain.
I have now moved to Sweden for love (awwww).
If you're in Scandinavia and want an MVP on the payroll (or happy with a remote worker), or need cotract work done, give me a job! http://cv.imcsoft.co.uk/[ ^]
|
|
|
|
|
Look at handling the WM_CHAR message.
"Old age is like a bank account. You withdraw later in life what you have deposited along the way." - Unknown
"Fireproof doesn't mean the fire will never come. It means when the fire comes that you will be able to withstand it." - Michael Simmons
|
|
|
|
|
Hi
I am IT pro,next year.
If my PC not DOS & empty OS then
I can write edit pratition FAT32 program with fopen,fread ?
fopen can run not DOS,OS ?
how to: do this,code
can access HDD (read,write file) when emtpy OS
I will compile codes top with NASM in 7c00
I can all this
Please,good code I don't like book,guide
[vietnam 2009.CD]
thanks
|
|
|
|
|
tuan1111 wrote: fopen can run not DOS,OS ?
This makes no sense, I am afraid.
Your question is not easy to understand, but I gather you are having trouble reading and writing disk records from your program. However any simple explanation may not be an answer to your real question.
tuan1111 wrote: Please,good code I don't like book,guide
This will not help, you must learn and understand these functions, if you wish to gain knowledge of software. I would suggest buying a book in your own language that will guide you in how to use these functions.
|
|
|
|
|
Have a look at these articles [^], [^].
If the Lord God Almighty had consulted me before embarking upon the Creation, I would have recommended something simpler.
-- Alfonso the Wise, 13th Century King of Castile.
This is going on my arrogant assumptions. You may have a superb reason why I'm completely wrong.
-- Iain Clarke
[My articles]
|
|
|
|
|
Thanks in advance for your input.
I am trying to write a program that will handle DNA sequence, which is essentially text consisting of the letters A,T,C and G. The problems I am facing are:
1) The text needs to be displayed as double lines of text where A is above T, C is above G and so on, but text selection should act (wrap, etc) like it is seeing only the top row. Below shows a selected region (in bold) that wraps from one line to the next.
ATGTGTCGATCGATCGATCGATAGGATATATATTGAAG
TACACAGCTAGCATGCTAGCTATCCTATATATAACTTC
TGGAGCTAGCTAGGATCGAGTCATCGATCGACGGTACG
ACCTCGATCGATCCTAGCTCAGTAGCTACGTGCCATGC
2) I'd like to be able to place symbols in the spaces between line.
Any ideas on how to accomplish one or the other (or even both) would be greatly appreciated.
Thanks
Eric
|
|
|
|
|
What type of program do you have in mind?
Console or UI?
If UI, dialog based or SDI/MDI?
Here is one way I would do it.
Place on a dialog, 3 rich edit boxes one below the other with its border set to none and its background color the same as that of a dialog.
The first is for the first row.
The second is for the symbols.
The third is for the second row.
When a selection is made in the first edit box, an EN_SELCHANGE notification will be sent.
You can make the same selection in the third edit box using CRichEditCtrl::SetSel .
As for showing symbols in the second edit box, check the character value of the needed symbol using the charmap tool. Type charmap in the Run dialog box.
«_Superman_»
I love work. It gives me something to do between weekends.
|
|
|
|
|
Thank you for your insights. I was hoping to turn it (eventually) into an MDI, but it could also be an SDI with more than one view. I will have to give your interesting suggestions a try.
Cheers,
Eric
|
|
|
|
|
Hi,
I need to import methods of GUI MFC dll ( Frame + Views...).by a client application (ie. console application).I tried do do the classic importation with __declspec(dllexport) but i have some problems with InitInstance() method and others.
So can you help me? and if there is some source codes it can be more helpful.
Thanks
|
|
|
|