C / C++ / MFC Discussion Boards

rtd client

trioum26-Sep-09 0:30

trioum

26-Sep-09 0:30

can we develop rtd client like excel to get data from rtd server

Trioum

Re: rtd client

CPallini26-Sep-09 2:22

CPallini

26-Sep-09 2:22

Yes, we can. Roll eyes | :rolleyes:

For instance I'm a famous RTD (ready to drink) client. Big Grin | :-D

If the Lord God Almighty had consulted me before embarking upon the Creation, I would have recommended something simpler.
-- Alfonso the Wise, 13th Century King of Castile.

This is going on my arrogant assumptions. You may have a superb reason why I'm completely wrong.
-- Iain Clarke

[My articles]

Re: rtd client

trioum26-Sep-09 2:47

trioum

26-Sep-09 2:47

how is it possible

Trioum

Re: rtd client

Rajesh R Subramanian26-Sep-09 9:36

Rajesh R Subramanian

26-Sep-09 9:36

trioum wrote:
can we develop rtd client like excel to get data from rtd server

Yes, that should be possible. Question answered. Period.

But "how to develop an rtd client" may not be a specific question. You might want to read the guidelines in that case...

It is a crappy thing, but it's life -^ Carlo Pallini

win mobile 6.1 whether or not Support audio compression manager?

wgh1689925-Sep-09 19:41

wgh16899

25-Sep-09 19:41

Hi,
I need to compress wave-pcm to gsm-format with acm(audio compression manager).
So can you help me? and if there is some source codes it can be more helpful.

Thanks

prohibit some character on edit box VC 6.0[solved]

Eka Candra25-Sep-09 19:25

Eka Candra

25-Sep-09 19:25

Dear all,

How to pohibit some character on edit box VC 6.0?
I have no idea about that.

Thanks and regards,

Eka Candra

Re: prohibit some character on edit box VC 6.0

theCPkid25-Sep-09 19:58

theCPkid

25-Sep-09 19:58

Check ON_EN_UPDATE message handler. Sent after the control has formatted the text but before it displays the text so that the window size can be altered, if necessary.

check this

Or In PreTranslateMessage(inside parent of edit box), you can do check for prohibited character -

if(pMsg->message == WM_KEYDOWN && pMsg->wParam == PROHIBITED_CHARACTER && pMsg->hWnd == MY_EDIT_BOX_WINDOW)
{
    return TRUE; //do not let windows process this message.
}

Re: prohibit some character on edit box VC 6.0

Eka Candra25-Sep-09 20:25

Eka Candra

25-Sep-09 20:25

Thank you for your help and answer.

I am not try it yet. Firstly, I will learn article that you give in your message.

thanks a lot...

Re: prohibit some character on edit box VC 6.0[solved]

Iain Clarke, Warrior Programmer25-Sep-09 20:52

Iain Clarke, Warrior Programmer

25-Sep-09 20:52

Have a look in the Edit Controls[^] section here on codeproject - there are many good articles here (thought that tutorial is a great start)

Masked and Validating Controls[^] is probably the subsection you want!

Iain.

I have now moved to Sweden for love (awwww).
If you're in Scandinavia and want an MVP on the payroll (or happy with a remote worker), or need cotract work done, give me a job! http://cv.imcsoft.co.uk/[^]

Re: prohibit some character on edit box VC 6.0[solved]

David Crow26-Sep-09 17:40

David Crow

26-Sep-09 17:40

Look at handling the WM_CHAR message.

"Old age is like a bank account. You withdraw later in life what you have deposited along the way." - Unknown

"Fireproof doesn't mean the fire will never come. It means when the fire comes that you will be able to withstand it." - Michael Simmons

VC or Turbo C 2.0 & Partition when empty OS

tuan111125-Sep-09 18:10

tuan1111

25-Sep-09 18:10

Hi I am IT pro,next year.
If my PC not DOS & empty OS then
I can write edit pratition FAT32 program with fopen,fread ?
fopen can run not DOS,OS ?
D'Oh! | :doh:

how to: do this,code
can access HDD (read,write file) when emtpy OS
I will compile codes top with NASM in 7c00
I can all this Sniff | :^)

Please,good code I don't like book,guide Unsure | :~

[vietnam 2009.CD]
thanks Wink | ;)

Re: VC or Turbo C 2.0 & Partition when empty OS

Richard MacCutchan25-Sep-09 23:47

Richard MacCutchan

25-Sep-09 23:47

tuan1111 wrote:
fopen can run not DOS,OS ?

This makes no sense, I am afraid.

Your question is not easy to understand, but I gather you are having trouble reading and writing disk records from your program. However any simple explanation may not be an answer to your real question.

tuan1111 wrote:
Please,good code I don't like book,guide

This will not help, you must learn and understand these functions, if you wish to gain knowledge of software. I would suggest buying a book in your own language that will guide you in how to use these functions.

Re: VC or Turbo C 2.0 & Partition when empty OS

CPallini26-Sep-09 11:29

CPallini

26-Sep-09 11:29

Have a look at these articles [^], [^].
Smile | :)

Handling DNA sequence data as text

Er1cS25-Sep-09 12:18

Er1cS

25-Sep-09 12:18

Thanks in advance for your input.

I am trying to write a program that will handle DNA sequence, which is essentially text consisting of the letters A,T,C and G. The problems I am facing are:

1) The text needs to be displayed as double lines of text where A is above T, C is above G and so on, but text selection should act (wrap, etc) like it is seeing only the top row. Below shows a selected region (in bold) that wraps from one line to the next.

ATGTGTCGATCGATCGATCGATAGGATATATATTGAAG
TACACAGCTAGCATGCTAGCTATCCTATATATAACTTC

TGGAGCTAGCTAGGATCGAGTCATCGATCGACGGTACG
ACCTCGATCGATCCTAGCTCAGTAGCTACGTGCCATGC

2) I'd like to be able to place symbols in the spaces between line.

Any ideas on how to accomplish one or the other (or even both) would be greatly appreciated.

Thanks

Eric

Re: Handling DNA sequence data as text

«_Superman_»25-Sep-09 16:38

«_Superman_»

25-Sep-09 16:38

What type of program do you have in mind?
Console or UI?
If UI, dialog based or SDI/MDI?

Here is one way I would do it.

Place on a dialog, 3 rich edit boxes one below the other with its border set to none and its background color the same as that of a dialog.

The first is for the first row.
The second is for the symbols.
The third is for the second row.

When a selection is made in the first edit box, an EN_SELCHANGE notification will be sent.
You can make the same selection in the third edit box using CRichEditCtrl::SetSel.

As for showing symbols in the second edit box, check the character value of the needed symbol using the charmap tool. Type charmap in the Run dialog box.

«_Superman_»
I love work. It gives me something to do between weekends.

Re: Handling DNA sequence data as text

Er1cS25-Sep-09 18:22

Er1cS

25-Sep-09 18:22

Thank you for your insights. I was hoping to turn it (eventually) into an MDI, but it could also be an SDI with more than one view. I will have to give your interesting suggestions a try.

Cheers,

Eric

import GUI MFC dll

MrKBA25-Sep-09 11:08

MrKBA

25-Sep-09 11:08

Hi,
I need to import methods of GUI MFC dll ( Frame + Views...).by a client application (ie. console application).I tried do do the classic importation with __declspec(dllexport) but i have some problems with InitInstance() method and others.

So can you help me? and if there is some source codes it can be more helpful.

Thanks

Re: import GUI MFC dll

Richard Andrew x6425-Sep-09 12:44

Richard Andrew x64

25-Sep-09 12:44

The functions in the MFC dll are all designed to work within the MFC framework.

You can't import selected functions and expect them to work out of context.

Try recreating your project as an MFC console application.

Re: import GUI MFC dll

MrKBA26-Sep-09 1:52

MrKBA

26-Sep-09 1:52

but what i want is to create a dll which has a Frame, a View and a Document (GUI) and use it by an other application !!!

Re: import GUI MFC dll

Richard Andrew x6426-Sep-09 5:57

Richard Andrew x64

26-Sep-09 5:57

Then you should look up creating an MFC dll.

There is a lot of documentation on that in MSDN.

Up-Down control

dipuks25-Sep-09 8:58

dipuks

25-Sep-09 8:58

Hello

I am working on an Up-Down spin control which is used to update values in
a text control.

The range of values are from 20 to -20.

What i have seen is, if i click the UP or DOWN arrow and keep it
pressed, then somehow after counting 15 it will stop decrementing or inceremting.

i.e., if the current value is 20 and now am clicking the DOWN button and keep
it pressed, the text control value will decrement upto 5, and then will stop there.

Now i have to release the mouse button and then again click the DOWN arrow to further decrement.
Now again after 15 decrements it will stop decrementing and i have to release the
mouse and click again.

Any idea why this happening?

Re: Up-Down control

David Crow25-Sep-09 9:08

David Crow

25-Sep-09 9:08

dipuks wrote:
I am working on an Up-Down spin control which is used to update values in
a text control.

Are you referring to an msctls_updown32 control? If you are using MFC, do you have a CSpinButtonCtrl object associated with it?

dipuks wrote:
The range of values are from 20 to -20.

How did you set this range?

I just tried this and it works fine for me.

Re: Up-Down control

dipuks25-Sep-09 9:25

dipuks

25-Sep-09 9:25

Are you referring to an msctls_updown32 control?

YES

If you are using MFC, do you have a CSpinButtonCtrl object associated with it?

I am not using MFC, am working using Win32 API's

Re: Up-Down control

David Crow25-Sep-09 9:28

David Crow

25-Sep-09 9:28

dipuks wrote:
I am not using MFC, am working using Win32 API's

So then are you sending the control a UDM_SETRANGE message?

Re: Up-Down control

dipuks25-Sep-09 9:37

dipuks

25-Sep-09 9:37

Yes UDM_SETRANGE32

Am using all 32 bit messages,

UDM_SETPOS32, UDM_GETPOS32,...

in UDM_DELTAPOS i try to update the value in text control

Use Ctrl+Left/Right to switch messages, Ctrl+Up/Down to switch threads, Ctrl+Shift+Left/Right to switch pages.