C / C++ / MFC Discussion Boards

CPallini26-Sep-09 11:16

26-Sep-09 11:16

You may load the log image usign a CImage object (taht is able to load both formats) and then check (or just adapt) the size.
Smile | :)

If the Lord God Almighty had consulted me before embarking upon the Creation, I would have recommended something simpler.
-- Alfonso the Wise, 13th Century King of Castile.

This is going on my arrogant assumptions. You may have a superb reason why I'm completely wrong.
-- Iain Clarke

[My articles]

How can I correct MFC focus problem after closing HtmlHelp window?

Tom M26-Sep-09 2:51

Tom M

26-Sep-09 2:51

I'm having a problem with an MFC app. I open a modal dialog, press F1,
HTML Help pops up with the appropriate context sensitive help. I close
the Help Window and can then press any shortcut key (such as Ctrl+O
for open) and the app will open the file open dialog, even though the
modal dialog is still visible and should have the keybord focus.

I'm using the new MFC feature pack.

This behavior can be duplicated with a stock MFC application. Using
the MFC Application Wizard, build a SDI app with Context Sensatvie
Help. Leave all other options at the default. Build and run the app.
Open the Help About dialog, Press F1, Close the Help Window, press Ctrl
+O, you'll see this issue.

If after closing the Help Window you click the app window or dialog
box with the mouse the focus is set properly and pressing shortcut
keys does nothing.

It appears that this might be a defect in the new MFC featrue pack
classes. Does anyone have an idea as to how I can correct this
behavior?

Thanks.

Re: How can I correct MFC focus problem after closing HtmlHelp window?

Richard MacCutchan26-Sep-09 3:50

Richard MacCutchan

26-Sep-09 3:50

Tom M wrote:
It appears that this might be a defect in the new MFC featrue pack
classes. Does anyone have an idea as to how I can correct this
behavior?

Who created this feature pack? Maybe you should tell them about it.

Google map from lat/long

colemans26-Sep-09 2:50

colemans

26-Sep-09 2:50

My program generates a latitude and longitude and I would like to display a map of the area with the exact location marked.

Is Google Maps the best way to go for this?

At the moment I do not want the map to be embedded in my program. I would be happy just to spawn the default web browser passing it a maps.google.com URL that would display the correct Google Map with the location marked accurately.

Is there a page which describes how to construct the necessary URL ?

Also, do Google allow this sort of use for free, or would their terms require a fee for programs which spawn the map in a web browser like this?

Re: Google map from lat/long

Stuart Dootson26-Sep-09 4:35

Stuart Dootson

26-Sep-09 4:35

Does this[^] help?

Why not embed a browser (IE? WebKit if you're feeling ambitious) in your program? That'd be cool!

Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p

Re: Google map from lat/long

tiresias226-Sep-09 11:37

tiresias2

26-Sep-09 11:37

Thanks, that's a great help. Embedding a browser sounds interesting - I'm still using VC++ 2003, would that be too old to use WebKit?

Is there anything else provided by Microsoft that can be used to create a web browser within a program's window?

Re: Google map from lat/long

Stuart Dootson26-Sep-09 11:59

Stuart Dootson

26-Sep-09 11:59

Note: WebKit is the open-source HTML engine used in Google Chrome and Apple Safari. It is wrapped in a class in the Qt library.

colinbr wrote:
would that be too old to use WebKit?

No - but other than Qt, I'm not sure of easy ways of using it.

colinbr wrote:
Is there anything else provided by Microsoft that can be used to create a web browser within a program's window?

IE. Use the MSHTML ActiveX control. It's pretty simple and (if you've already got an MFC program running) probably easiest.

Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p

Re: Google map from lat/long

tiresias226-Sep-09 13:06

tiresias2

26-Sep-09 13:06

Thanks, I'll look at that. When I created ny project originally I did not have ActiveX ticked in the project wizard. I don't relish the thought of recreating the project from scratch, so is there a simple list of changes I can make manually to the project files that would add ActiveX support?

Incidentally I found a reference to Microsoft's CHtmlView which I think is a wrapper around the ActiveX control - and also a CHtmlCtrl which allows CHtmlView to be used in a dialog window. But there seemed to be comments about memory leaks.

Would it be easier/safer to go for the ActiveX control itself - I guess this is

http://msdn.microsoft.com/en-us/library/aa752046%28VS.85%29.aspx[^]

or to go for the CHtmlView/CHtmlCtrl solution?

Re: Google map from lat/long

Stuart Dootson26-Sep-09 13:09

Stuart Dootson

26-Sep-09 13:09

I would have thought that CHtmlView/CHtmlCtrl would wrap the ActiveX control. I'm not sure what's required for ActiveX support in MFC - I've only used the Web Browser ActiveX control in WTL, which doesn't require you to enable ActiveX support at a project level.

Java, Basic, who cares - it's all a bunch of tree-hugging hippy cr*p

Re: Google map from lat/long

tiresias227-Sep-09 12:09

tiresias2

27-Sep-09 12:09

Thanks.

What is the key code for PowerOff/SwitchOff button for Windows mobile.. [modified]

Rushikesh12326-Sep-09 1:35

Rushikesh123

26-Sep-09 1:35

Hello Guys,

I am trying to handle key code for power key/switch off key for Windows mobile in MFC application but still to get the correct key code for the same.

Your inputs are most welcome. Waiting for your reply.

Thanks in advance.

Regards,
Rushikesh123

modified on Tuesday, September 29, 2009 12:43 AM

rtd client

trioum26-Sep-09 0:30

trioum

26-Sep-09 0:30

can we develop rtd client like excel to get data from rtd server

Trioum

Re: rtd client

CPallini26-Sep-09 2:22

CPallini

26-Sep-09 2:22

Yes, we can. Roll eyes | :rolleyes:

For instance I'm a famous RTD (ready to drink) client. Big Grin | :-D

Re: rtd client

trioum26-Sep-09 2:47

trioum

26-Sep-09 2:47

how is it possible

Trioum

Re: rtd client

Rajesh R Subramanian26-Sep-09 9:36

Rajesh R Subramanian

26-Sep-09 9:36

trioum wrote:
can we develop rtd client like excel to get data from rtd server

Yes, that should be possible. Question answered. Period.

But "how to develop an rtd client" may not be a specific question. You might want to read the guidelines in that case...

It is a crappy thing, but it's life -^ Carlo Pallini

win mobile 6.1 whether or not Support audio compression manager?

wgh1689925-Sep-09 19:41

wgh16899

25-Sep-09 19:41

Hi,
I need to compress wave-pcm to gsm-format with acm(audio compression manager).
So can you help me? and if there is some source codes it can be more helpful.

Thanks

prohibit some character on edit box VC 6.0[solved]

Eka Candra25-Sep-09 19:25

Eka Candra

25-Sep-09 19:25

Dear all,

How to pohibit some character on edit box VC 6.0?
I have no idea about that.

Thanks and regards,

Eka Candra

Re: prohibit some character on edit box VC 6.0

theCPkid25-Sep-09 19:58

theCPkid

25-Sep-09 19:58

Check ON_EN_UPDATE message handler. Sent after the control has formatted the text but before it displays the text so that the window size can be altered, if necessary.

check this

Or In PreTranslateMessage(inside parent of edit box), you can do check for prohibited character -

if(pMsg->message == WM_KEYDOWN && pMsg->wParam == PROHIBITED_CHARACTER && pMsg->hWnd == MY_EDIT_BOX_WINDOW)
{
    return TRUE; //do not let windows process this message.
}

Re: prohibit some character on edit box VC 6.0

Eka Candra25-Sep-09 20:25

Eka Candra

25-Sep-09 20:25

Thank you for your help and answer.

I am not try it yet. Firstly, I will learn article that you give in your message.

thanks a lot...

Re: prohibit some character on edit box VC 6.0[solved]

Iain Clarke, Warrior Programmer25-Sep-09 20:52

Iain Clarke, Warrior Programmer

25-Sep-09 20:52

Have a look in the Edit Controls[^] section here on codeproject - there are many good articles here (thought that tutorial is a great start)

Masked and Validating Controls[^] is probably the subsection you want!

Iain.

I have now moved to Sweden for love (awwww).
If you're in Scandinavia and want an MVP on the payroll (or happy with a remote worker), or need cotract work done, give me a job! http://cv.imcsoft.co.uk/[^]

Re: prohibit some character on edit box VC 6.0[solved]

David Crow26-Sep-09 17:40

David Crow

26-Sep-09 17:40

Look at handling the WM_CHAR message.

"Old age is like a bank account. You withdraw later in life what you have deposited along the way." - Unknown

"Fireproof doesn't mean the fire will never come. It means when the fire comes that you will be able to withstand it." - Michael Simmons

VC or Turbo C 2.0 & Partition when empty OS

tuan111125-Sep-09 18:10

tuan1111

25-Sep-09 18:10

Hi I am IT pro,next year.
If my PC not DOS & empty OS then
I can write edit pratition FAT32 program with fopen,fread ?
fopen can run not DOS,OS ?
D'Oh! | :doh:

how to: do this,code
can access HDD (read,write file) when emtpy OS
I will compile codes top with NASM in 7c00
I can all this Sniff | :^)

Please,good code I don't like book,guide Unsure | :~

[vietnam 2009.CD]
thanks Wink | ;)

Re: VC or Turbo C 2.0 & Partition when empty OS

Richard MacCutchan25-Sep-09 23:47

Richard MacCutchan

25-Sep-09 23:47

tuan1111 wrote:
fopen can run not DOS,OS ?

This makes no sense, I am afraid.

Your question is not easy to understand, but I gather you are having trouble reading and writing disk records from your program. However any simple explanation may not be an answer to your real question.

tuan1111 wrote:
Please,good code I don't like book,guide

This will not help, you must learn and understand these functions, if you wish to gain knowledge of software. I would suggest buying a book in your own language that will guide you in how to use these functions.

Re: VC or Turbo C 2.0 & Partition when empty OS

CPallini26-Sep-09 11:29

CPallini

26-Sep-09 11:29

Have a look at these articles [^], [^].
Smile | :)

Handling DNA sequence data as text

Er1cS25-Sep-09 12:18

Er1cS

25-Sep-09 12:18

Thanks in advance for your input.

I am trying to write a program that will handle DNA sequence, which is essentially text consisting of the letters A,T,C and G. The problems I am facing are:

1) The text needs to be displayed as double lines of text where A is above T, C is above G and so on, but text selection should act (wrap, etc) like it is seeing only the top row. Below shows a selected region (in bold) that wraps from one line to the next.

ATGTGTCGATCGATCGATCGATAGGATATATATTGAAG
TACACAGCTAGCATGCTAGCTATCCTATATATAACTTC

TGGAGCTAGCTAGGATCGAGTCATCGATCGACGGTACG
ACCTCGATCGATCCTAGCTCAGTAGCTACGTGCCATGC

2) I'd like to be able to place symbols in the spaces between line.

Any ideas on how to accomplish one or the other (or even both) would be greatly appreciated.

Thanks

Eric

Use Ctrl+Left/Right to switch messages, Ctrl+Up/Down to switch threads, Ctrl+Shift+Left/Right to switch pages.